Review




Structured Review

10X Genomics visium spatial transcriptome sequencing
Visium Spatial Transcriptome Sequencing, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sequencing+visium+spatial+transcriptomics/spatial+transcriptome+visium/pm40200175-180-3-1
Average 90 stars, based on 1 article reviews
visium spatial transcriptome sequencing - by Bioz Stars, 2026-10
90/100 stars

Images

Related Articles

Spatial Transcriptomics:

Article Title: Single-cell and spatial transcriptomics unveil myeloid-lymphoid crosstalk and the dermal immune niche underlying palmoplantar pustulosis.
Article Snippet: This is a PDF of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability.. This version will undergo additional copyediting, typesetting and review before it is published in its final form.. As such, this version is no longer the Accepted Manuscript, but it is not yet the definitive Version of Record; we are providing this early version to give early visibility of the article.

Article Title: Multiplexed transcriptomic analyzes of the plant embryonic hourglass
Article Snippet: .. To further validate the identification of Stage 1 embryo single cell clusters, eight individual Stage 1 embryo sections were processed using the 10X Genomics Visium TM spatial transcriptomics pipeline (Fig. and Supplementary Data ). ..

Article Title: 4D multimodal wound healing atlas reveals organ-level controls of repair phase transitions
Article Snippet: .. Spatial Transcriptomics data was generated using 10x Genomics Visium V2 CytAssist Spatial Gene Expression Mouse Transcriptome Assay (#1000445) for FFPE tissue as per user’s guide. .. The resulting libraries were sequenced on an Illumina NovaSeqX sequencer with pair-end 2×150 bp targeting 300 million reads per sample.

Article Title: Gene Spatial Integration: enhancing spatial transcriptomics analysis via deep learning and batch effect mitigation.
Article Snippet: .. Despite these promising array of Spatial Transcriptomics techniques, our primary focus is on in situ sequencing-based 10x Genomics Visium technology. ..

Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

Sequencing:

Article Title: Single-cell and spatial transcriptomics unveil myeloid-lymphoid crosstalk and the dermal immune niche underlying palmoplantar pustulosis.
Article Snippet: This is a PDF of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability.. This version will undergo additional copyediting, typesetting and review before it is published in its final form.. As such, this version is no longer the Accepted Manuscript, but it is not yet the definitive Version of Record; we are providing this early version to give early visibility of the article.

Article Title: Cellular microenvironment of erythropoietin‐producing cells in hypoxic and injured mouse kidneys
Article Snippet: .. Using the SpaceRanger software (10x Genomics), Fastq sequence files were processed and aligned to the mouse reference genome GRCm38, and Visium spots (55 μm in diameter) were mapped to the corresponding Haematoxylin‐ and Eosin‐stained tissue images. ..

Article Title: Gene Spatial Integration: enhancing spatial transcriptomics analysis via deep learning and batch effect mitigation.
Article Snippet: .. Despite these promising array of Spatial Transcriptomics techniques, our primary focus is on in situ sequencing-based 10x Genomics Visium technology. ..

Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

Generated:

Article Title: Single-cell and spatial transcriptomics unveil myeloid-lymphoid crosstalk and the dermal immune niche underlying palmoplantar pustulosis.
Article Snippet: This is a PDF of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability.. This version will undergo additional copyediting, typesetting and review before it is published in its final form.. As such, this version is no longer the Accepted Manuscript, but it is not yet the definitive Version of Record; we are providing this early version to give early visibility of the article.

Article Title: 4D multimodal wound healing atlas reveals organ-level controls of repair phase transitions
Article Snippet: .. Spatial Transcriptomics data was generated using 10x Genomics Visium V2 CytAssist Spatial Gene Expression Mouse Transcriptome Assay (#1000445) for FFPE tissue as per user’s guide. .. The resulting libraries were sequenced on an Illumina NovaSeqX sequencer with pair-end 2×150 bp targeting 300 million reads per sample.

Single Cell:

Article Title: Multiplexed transcriptomic analyzes of the plant embryonic hourglass
Article Snippet: .. To further validate the identification of Stage 1 embryo single cell clusters, eight individual Stage 1 embryo sections were processed using the 10X Genomics Visium TM spatial transcriptomics pipeline (Fig. and Supplementary Data ). ..

Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

Software:

Article Title: Cellular microenvironment of erythropoietin‐producing cells in hypoxic and injured mouse kidneys
Article Snippet: .. Using the SpaceRanger software (10x Genomics), Fastq sequence files were processed and aligned to the mouse reference genome GRCm38, and Visium spots (55 μm in diameter) were mapped to the corresponding Haematoxylin‐ and Eosin‐stained tissue images. ..

Gene Expression:

Article Title: 4D multimodal wound healing atlas reveals organ-level controls of repair phase transitions
Article Snippet: .. Spatial Transcriptomics data was generated using 10x Genomics Visium V2 CytAssist Spatial Gene Expression Mouse Transcriptome Assay (#1000445) for FFPE tissue as per user’s guide. .. The resulting libraries were sequenced on an Illumina NovaSeqX sequencer with pair-end 2×150 bp targeting 300 million reads per sample.

Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

Article Title: Spatial atlas of human diabetic kidney uncovered podocyte-driven metabolic-inflammatory crosstalk via glycerolipid reprogramming and DUSP4/MMP3 axis
Article Snippet: .. Visium HD spatial profiling was carried out on 6.5 mm2 slides (10x Genomics, PN-2000970) using the Human Spatial Gene Expression Reagent Kit (PN-1000675). ..

Formalin-fixed Paraffin-Embedded:

Article Title: 4D multimodal wound healing atlas reveals organ-level controls of repair phase transitions
Article Snippet: .. Spatial Transcriptomics data was generated using 10x Genomics Visium V2 CytAssist Spatial Gene Expression Mouse Transcriptome Assay (#1000445) for FFPE tissue as per user’s guide. .. The resulting libraries were sequenced on an Illumina NovaSeqX sequencer with pair-end 2×150 bp targeting 300 million reads per sample.

Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

In Situ:

Article Title: Gene Spatial Integration: enhancing spatial transcriptomics analysis via deep learning and batch effect mitigation.
Article Snippet: .. Despite these promising array of Spatial Transcriptomics techniques, our primary focus is on in situ sequencing-based 10x Genomics Visium technology. ..

Staining:

Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

Blocking Assay:

Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

Amplification:

Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

Polymer:

Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

Labeling:

Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

RNA Sequencing:

Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..



Similar Products

86
Spatial Transcriptomics Inc visium cytassist spatial transcriptomics sequencing
Visium Cytassist Spatial Transcriptomics Sequencing, supplied by Spatial Transcriptomics Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sequencing+visium+spatial+transcriptomics/cytassist+expression+gene+kits+reagent+spatial+visium/pm41250997-332-1-3
Average 86 stars, based on 1 article reviews
visium cytassist spatial transcriptomics sequencing - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Spatial Transcriptomics Inc visium spatial transcriptomics sequencing
Single‐cell and spatial transcriptome landscape of healthy and fibrotic kidneys after unilateral ischemia‐reperfusion injury (UIRI). a) Schematic representation of single‐cell RNA <t>sequencing</t> (scRNA‐seq) and spatial <t>transcriptomics</t> (ST) of kidneys from the sham and 10‐day UIRI mice, graphically designed with Biorender ( https://www.biorender.com/ ). b) t‐SNE plot illustrating the intricate cellular diversity in fibrotic kidneys, demonstrating distinct clusters representing glomerular endothelial cells (GEC), podocytes (Podo), mesangial cells (Mesa), Bowman's capsule epithelium (BC), proximal tubules (PT), descending limbs of Henle (DLOH), ascending limbs of Henle (ALOH), distal tubules (DT), principal cells (PC), intercalated cells (IC), fibroblasts (Fib), smooth muscle cells (SMC), extraglomerular endothelial cells (EGEC), monocytes (Mono), dendritic cells (DC), macrophages (Mϕ), plasmacytoid dendritic cells (pDC), proliferating mononuclear lineage (Prolif mono_L), and neutrophils (Neu), B cells (B), T cells (T), proliferating T cells (prolif T), and natural killer cells (NK). These cell types were further categorized into four major compartments: Glomerular, Renal, Interstitium, and Immune, as indicated by color grouping in the plot. c) Bubble plot illustrating the relative proportions of major kidney cell types in sham and UIRI samples. Each dot represents the proportion of a given cell type in a specific sample group, with dot size corresponding to its relative proportion. d) A comprehensive heatmap depicting the unique marker gene signature of major renal cell types. e) UMAP plot illustrating the inferred renal cell region distribution based on integrated spatial transcriptomics data from normal (Sham) and UIRI 10D mouse kidneys, generated using the 10x Genomics <t>Visium</t> platform. The identified regions include glomerular cells (Glom), distinct segments of the proximal tubule (PTS1, PTS1S2, PTS2), injured proximal tubules (InjPT), ascending limbs of Henle in cortex (ALOH(C)), distal tubules (DT), connecting tubules and collecting ducts (CNT_CD), cells at the corticomedullary junction (CMJ), fibrogenic niche regions (Niche1, Niche2), the inner stripe of the outer medulla (IOM), inner medulla (IM), renal capsule (RC), and perirenal tissue (Perirenal). f) Spatial maps illustrating the anatomical distribution of renal cell regions in Sham and UIRI 10D mouse kidneys. Region colors correspond to the classifications defined in panel (e). g) Bubble plot illustrating the relative proportions of major renal cell regions in spatial transcriptomics data from sham and UIRI 10D mouse kidneys. h) Bubble plot depicting the expression patterns of marker genes across distinct renal cell regions in spatial transcriptomics data. Dot color indicates the average gene expression level within each region, while dot size represents the proportion of spatial spots expressing the gene. i) Schematic diagram of nephron segmentation by cell types. j) Comparison of kidney anatomical regions and spatial transcriptomic clusters, showing clusters in kidney tissue (top) and the corresponding Visium H&E‐stained section (bottom). k) Renal tissue structure alterations at the corticomedullary junction (CMJ) in UIRI samples, showing the formation of two distinct fibrogenic niches, Niche1 and Niche2. l) A heatmap showing the deconvolution scores of cell type compositions across different regions in Visium spatial transcriptomics data, obtained using the RCTD method. m) Spatial FeaturePlots of RCTD‐derived cell type scores in the sham (top) and UIRI (bottom) groups, with paired panels sharing a common legend.
Visium Spatial Transcriptomics Sequencing, supplied by Spatial Transcriptomics Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sequencing+visium+spatial+transcriptomics/sequencing+spatial+transcriptomics+visium/pmc12786295-261-6-7
Average 86 stars, based on 1 article reviews
visium spatial transcriptomics sequencing - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Spatial Transcriptomics Inc sequencing visium spatial transcriptomics technologies impact deep learning based gene expression prediction
A. Acquisition of paired breast cancer spatial <t>transcriptomics</t> datasets and histology images from 10x <t>Visium</t> and Xenium. B. Co-registration of Visium and Xenium histology slides into a common coordinate system. The green box highlights the overlapping region retained between the two technologies. C. Rasterization of gene counts onto a uniform grid matched to Visium spot resolution, followed by extraction of the overlapping tissue region. Expression is visualized as patches. D. Training of deep learning models to predict per-patch gene expression from histology image patches. E. Performance evaluation on held-out replicates, comparison across technologies, and ablation experiments of inputs.
Sequencing Visium Spatial Transcriptomics Technologies Impact Deep Learning Based Gene Expression Prediction, supplied by Spatial Transcriptomics Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sequencing+visium+spatial+transcriptomics/visium/bio_rxiv__2025__09__04__674228-3-18-20
Average 86 stars, based on 1 article reviews
sequencing visium spatial transcriptomics technologies impact deep learning based gene expression prediction - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Spatial Transcriptomics Inc noncirrhotic visium spatial transcriptomics single nucleus rna sequencing hepatocyte metallothioneinenriched hepatocyte fibroblasts
A. Acquisition of paired breast cancer spatial <t>transcriptomics</t> datasets and histology images from 10x <t>Visium</t> and Xenium. B. Co-registration of Visium and Xenium histology slides into a common coordinate system. The green box highlights the overlapping region retained between the two technologies. C. Rasterization of gene counts onto a uniform grid matched to Visium spot resolution, followed by extraction of the overlapping tissue region. Expression is visualized as patches. D. Training of deep learning models to predict per-patch gene expression from histology image patches. E. Performance evaluation on held-out replicates, comparison across technologies, and ablation experiments of inputs.
Noncirrhotic Visium Spatial Transcriptomics Single Nucleus Rna Sequencing Hepatocyte Metallothioneinenriched Hepatocyte Fibroblasts, supplied by Spatial Transcriptomics Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sequencing+visium+spatial+transcriptomics/visium/10__1097_slash_hep__0000000000001478-45-40-42
Average 86 stars, based on 1 article reviews
noncirrhotic visium spatial transcriptomics single nucleus rna sequencing hepatocyte metallothioneinenriched hepatocyte fibroblasts - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

90
10X Genomics visium spatial transcriptome sequencing
A. Acquisition of paired breast cancer spatial <t>transcriptomics</t> datasets and histology images from 10x <t>Visium</t> and Xenium. B. Co-registration of Visium and Xenium histology slides into a common coordinate system. The green box highlights the overlapping region retained between the two technologies. C. Rasterization of gene counts onto a uniform grid matched to Visium spot resolution, followed by extraction of the overlapping tissue region. Expression is visualized as patches. D. Training of deep learning models to predict per-patch gene expression from histology image patches. E. Performance evaluation on held-out replicates, comparison across technologies, and ablation experiments of inputs.
Visium Spatial Transcriptome Sequencing, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sequencing+visium+spatial+transcriptomics/spatial+transcriptome+visium/pm40200175-180-3-1
Average 90 stars, based on 1 article reviews
visium spatial transcriptome sequencing - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Spatial Transcriptomics Inc sequencing visium spatial transcriptomics
A. Acquisition of paired breast cancer spatial <t>transcriptomics</t> datasets and histology images from 10x <t>Visium</t> and Xenium. B. Co-registration of Visium and Xenium histology slides into a common coordinate system. The green box highlights the overlapping region retained between the two technologies. C. Rasterization of gene counts onto a uniform grid matched to Visium spot resolution, followed by extraction of the overlapping tissue region. Expression is visualized as patches. D. Training of deep learning models to predict per-patch gene expression from histology image patches. E. Performance evaluation on held-out replicates, comparison across technologies, and ablation experiments of inputs.
Sequencing Visium Spatial Transcriptomics, supplied by Spatial Transcriptomics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sequencing+visium+spatial+transcriptomics/10x+spatial+transcriptomics/bio_rxiv__2024__12__20__629638-395-31-16
Average 90 stars, based on 1 article reviews
sequencing visium spatial transcriptomics - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

86
10X Genomics visium spatial transcriptomic sequencing
(A) Procedures of NGS-based method of spatial <t>transcriptomic.</t> (B) Procedures of imaging-based method of spatial transcriptomic. (C) Schematic diagram of MALDI. The process begins with the preparation of the MALDI sample, followed by the application of MALDI for the matrix deposition. Subsequently, laser scanning technology is employed for the collection, processing, and analysis of signals. Finally, the signals and multi-image data are integrated for visualization. Created with Figdraw, https://www.figdraw.com .
Visium Spatial Transcriptomic Sequencing, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sequencing+visium+spatial+transcriptomics/expression+gene+slides+spatial+visium/pmc11404479-9-6-4
Average 86 stars, based on 1 article reviews
visium spatial transcriptomic sequencing - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

90
Spatial Transcriptomics Inc visium spatial transcriptomics sequencing data
Spatial <t>Transcriptomics</t> in horizontally sectioned E14.5 mouse diaphragm identifies distinct tissues and muscle domains (A) Schematic representation of embryonic mouse diaphragm in which relevant anatomical regions are indicated. NMJ: Neuromuscular junction, MTJ: Myotendinous junction. (B) SpatialFeaturePlots demonstrating expression levels and distributions of representative genes for muscle, NMJ, MTJ and tendon. (C) SpatialDimPlot demonstrating the distribution of all the identified clusters within the diaphragm tissue. (D) Spatial distribution of representative Seurat clusters differentiating genetically specific domains in developing mouse diaphragm. (E) Uniform Manifold Approximation and Projection (UMAP) diagram of identified clusters of spatial RNA <t>sequencing</t> with muscle and endothelial clusters at the left and tendon and erythrocyte clusters at right. (F) FeaturePlots showing expression of muscle ( Ttn , Myh3 , Myh8 ), crural diaphragm ( Crlf1 ), NMJ ( Chrna1 , Chrng , Musk, Etv5 ), MTJ ( Col22a1 , Ankrd1 , Rxrg , Csrp3 ) and tendon ( Col12a1 , Antxr1, Tnmd , Tnc ) markers displayed by UMAP.
Visium Spatial Transcriptomics Sequencing Data, supplied by Spatial Transcriptomics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sequencing+visium+spatial+transcriptomics/10x+spatial+transcriptomics/pmc11177202-313-0-1
Average 90 stars, based on 1 article reviews
visium spatial transcriptomics sequencing data - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
10X Genomics spatial transcriptome rna sequencing (strna-seq) data for breast cancer samples, specific to the 10x visium platform
Spatial <t>Transcriptomics</t> in horizontally sectioned E14.5 mouse diaphragm identifies distinct tissues and muscle domains (A) Schematic representation of embryonic mouse diaphragm in which relevant anatomical regions are indicated. NMJ: Neuromuscular junction, MTJ: Myotendinous junction. (B) SpatialFeaturePlots demonstrating expression levels and distributions of representative genes for muscle, NMJ, MTJ and tendon. (C) SpatialDimPlot demonstrating the distribution of all the identified clusters within the diaphragm tissue. (D) Spatial distribution of representative Seurat clusters differentiating genetically specific domains in developing mouse diaphragm. (E) Uniform Manifold Approximation and Projection (UMAP) diagram of identified clusters of spatial RNA <t>sequencing</t> with muscle and endothelial clusters at the left and tendon and erythrocyte clusters at right. (F) FeaturePlots showing expression of muscle ( Ttn , Myh3 , Myh8 ), crural diaphragm ( Crlf1 ), NMJ ( Chrna1 , Chrng , Musk, Etv5 ), MTJ ( Col22a1 , Ankrd1 , Rxrg , Csrp3 ) and tendon ( Col12a1 , Antxr1, Tnmd , Tnc ) markers displayed by UMAP.
Spatial Transcriptome Rna Sequencing (Strna Seq) Data For Breast Cancer Samples, Specific To The 10x Visium Platform, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sequencing+visium+spatial+transcriptomics/cells+generated+with+the+10x+genomics+3%E2%80%99+v+2+protocol/pm38450906-83-9-20
Average 90 stars, based on 1 article reviews
spatial transcriptome rna sequencing (strna-seq) data for breast cancer samples, specific to the 10x visium platform - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results


Single‐cell and spatial transcriptome landscape of healthy and fibrotic kidneys after unilateral ischemia‐reperfusion injury (UIRI). a) Schematic representation of single‐cell RNA sequencing (scRNA‐seq) and spatial transcriptomics (ST) of kidneys from the sham and 10‐day UIRI mice, graphically designed with Biorender ( https://www.biorender.com/ ). b) t‐SNE plot illustrating the intricate cellular diversity in fibrotic kidneys, demonstrating distinct clusters representing glomerular endothelial cells (GEC), podocytes (Podo), mesangial cells (Mesa), Bowman's capsule epithelium (BC), proximal tubules (PT), descending limbs of Henle (DLOH), ascending limbs of Henle (ALOH), distal tubules (DT), principal cells (PC), intercalated cells (IC), fibroblasts (Fib), smooth muscle cells (SMC), extraglomerular endothelial cells (EGEC), monocytes (Mono), dendritic cells (DC), macrophages (Mϕ), plasmacytoid dendritic cells (pDC), proliferating mononuclear lineage (Prolif mono_L), and neutrophils (Neu), B cells (B), T cells (T), proliferating T cells (prolif T), and natural killer cells (NK). These cell types were further categorized into four major compartments: Glomerular, Renal, Interstitium, and Immune, as indicated by color grouping in the plot. c) Bubble plot illustrating the relative proportions of major kidney cell types in sham and UIRI samples. Each dot represents the proportion of a given cell type in a specific sample group, with dot size corresponding to its relative proportion. d) A comprehensive heatmap depicting the unique marker gene signature of major renal cell types. e) UMAP plot illustrating the inferred renal cell region distribution based on integrated spatial transcriptomics data from normal (Sham) and UIRI 10D mouse kidneys, generated using the 10x Genomics Visium platform. The identified regions include glomerular cells (Glom), distinct segments of the proximal tubule (PTS1, PTS1S2, PTS2), injured proximal tubules (InjPT), ascending limbs of Henle in cortex (ALOH(C)), distal tubules (DT), connecting tubules and collecting ducts (CNT_CD), cells at the corticomedullary junction (CMJ), fibrogenic niche regions (Niche1, Niche2), the inner stripe of the outer medulla (IOM), inner medulla (IM), renal capsule (RC), and perirenal tissue (Perirenal). f) Spatial maps illustrating the anatomical distribution of renal cell regions in Sham and UIRI 10D mouse kidneys. Region colors correspond to the classifications defined in panel (e). g) Bubble plot illustrating the relative proportions of major renal cell regions in spatial transcriptomics data from sham and UIRI 10D mouse kidneys. h) Bubble plot depicting the expression patterns of marker genes across distinct renal cell regions in spatial transcriptomics data. Dot color indicates the average gene expression level within each region, while dot size represents the proportion of spatial spots expressing the gene. i) Schematic diagram of nephron segmentation by cell types. j) Comparison of kidney anatomical regions and spatial transcriptomic clusters, showing clusters in kidney tissue (top) and the corresponding Visium H&E‐stained section (bottom). k) Renal tissue structure alterations at the corticomedullary junction (CMJ) in UIRI samples, showing the formation of two distinct fibrogenic niches, Niche1 and Niche2. l) A heatmap showing the deconvolution scores of cell type compositions across different regions in Visium spatial transcriptomics data, obtained using the RCTD method. m) Spatial FeaturePlots of RCTD‐derived cell type scores in the sham (top) and UIRI (bottom) groups, with paired panels sharing a common legend.

Journal: Advanced Science

Article Title: Single Cell and Spatial Transcriptomics Define a Proinflammatory and Profibrotic Niche After Kidney Injury

doi: 10.1002/advs.202503691

Figure Lengend Snippet: Single‐cell and spatial transcriptome landscape of healthy and fibrotic kidneys after unilateral ischemia‐reperfusion injury (UIRI). a) Schematic representation of single‐cell RNA sequencing (scRNA‐seq) and spatial transcriptomics (ST) of kidneys from the sham and 10‐day UIRI mice, graphically designed with Biorender ( https://www.biorender.com/ ). b) t‐SNE plot illustrating the intricate cellular diversity in fibrotic kidneys, demonstrating distinct clusters representing glomerular endothelial cells (GEC), podocytes (Podo), mesangial cells (Mesa), Bowman's capsule epithelium (BC), proximal tubules (PT), descending limbs of Henle (DLOH), ascending limbs of Henle (ALOH), distal tubules (DT), principal cells (PC), intercalated cells (IC), fibroblasts (Fib), smooth muscle cells (SMC), extraglomerular endothelial cells (EGEC), monocytes (Mono), dendritic cells (DC), macrophages (Mϕ), plasmacytoid dendritic cells (pDC), proliferating mononuclear lineage (Prolif mono_L), and neutrophils (Neu), B cells (B), T cells (T), proliferating T cells (prolif T), and natural killer cells (NK). These cell types were further categorized into four major compartments: Glomerular, Renal, Interstitium, and Immune, as indicated by color grouping in the plot. c) Bubble plot illustrating the relative proportions of major kidney cell types in sham and UIRI samples. Each dot represents the proportion of a given cell type in a specific sample group, with dot size corresponding to its relative proportion. d) A comprehensive heatmap depicting the unique marker gene signature of major renal cell types. e) UMAP plot illustrating the inferred renal cell region distribution based on integrated spatial transcriptomics data from normal (Sham) and UIRI 10D mouse kidneys, generated using the 10x Genomics Visium platform. The identified regions include glomerular cells (Glom), distinct segments of the proximal tubule (PTS1, PTS1S2, PTS2), injured proximal tubules (InjPT), ascending limbs of Henle in cortex (ALOH(C)), distal tubules (DT), connecting tubules and collecting ducts (CNT_CD), cells at the corticomedullary junction (CMJ), fibrogenic niche regions (Niche1, Niche2), the inner stripe of the outer medulla (IOM), inner medulla (IM), renal capsule (RC), and perirenal tissue (Perirenal). f) Spatial maps illustrating the anatomical distribution of renal cell regions in Sham and UIRI 10D mouse kidneys. Region colors correspond to the classifications defined in panel (e). g) Bubble plot illustrating the relative proportions of major renal cell regions in spatial transcriptomics data from sham and UIRI 10D mouse kidneys. h) Bubble plot depicting the expression patterns of marker genes across distinct renal cell regions in spatial transcriptomics data. Dot color indicates the average gene expression level within each region, while dot size represents the proportion of spatial spots expressing the gene. i) Schematic diagram of nephron segmentation by cell types. j) Comparison of kidney anatomical regions and spatial transcriptomic clusters, showing clusters in kidney tissue (top) and the corresponding Visium H&E‐stained section (bottom). k) Renal tissue structure alterations at the corticomedullary junction (CMJ) in UIRI samples, showing the formation of two distinct fibrogenic niches, Niche1 and Niche2. l) A heatmap showing the deconvolution scores of cell type compositions across different regions in Visium spatial transcriptomics data, obtained using the RCTD method. m) Spatial FeaturePlots of RCTD‐derived cell type scores in the sham (top) and UIRI (bottom) groups, with paired panels sharing a common legend.

Article Snippet: For the preparation of sections for Visium Spatial Transcriptomics sequencing, samples were equilibrated at −18 °C and a 10 μm thick section was cut onto the active sequencing area (6 mm x 6 mm) of a spatial barcoded slide.

Techniques: RNA Sequencing, Marker, Generated, Expressing, Gene Expression, Comparison, Staining, Derivative Assay

High‐resolution spatial transcriptomics and immunostaining reveal the TNC‐enriched fibroblast‐macrophage niche organization in fibrotic kidneys. a) Schematic diagram of the Visium HD workflow applied to kidney tissues from sham and UIRI model mice. b) UMAP visualization of integrated Visium HD spatial transcriptomics data from control mice (obtained from the 10x Genomics public dataset) and UIRI mice (this study), processed using canonical correlation analysis (CCA). This dimensionality reduction visualization reveals distinct clusters representing various renal parenchymal and stromal cell populations, including: Glomerulus, Vasculature, PTS1, PTS2, PTS1S2, InjPT, ascending limbs of Henle in cortex [ALOH(Cortex)], distal tubule and connecting tubule (DT_CNT), connecting tubule and collecting duct (CNT_CD), collecting duct in cortex [CD(Cortex)], PTS3, injured PTS3 (InjPTS3), Fibrogenic Niche, Vasa recta, loop of Henle in outer medulla [LOH(IOM)], collecting duct in outer medulla [CD(IOM)], collecting duct in inner medulla [CD(IM)], thin ascending limbs of Henle in inner medulla [tALOH(IM)], renal capsule (RC), Perirenal Fibrous tissue, and Perirenal Adipose tissue. c) Bubble plot comparing the regional distribution in Control versus UIRI 10d kidneys (Visium HD). d) Bubble plot depicting the expression patterns of marker genes across distinct renal cell regions in Visium HD data. e) Spatial maps generated using Visium HD illustrate the inferred anatomical distribution of renal cell regions in kidney tissues from Control and UIRI mice. f) Spatial Feature Plots of Visium HD data showing the spatial distribution of selected renal cell types in controls (top) and UIRI mice (bottom), based on cell‐type deconvolution using RCTD. g) A heatmap showing the correlation between NMF factors and cell‐type deconvolution scores in standard Visium spatial transcriptomics data. h) Spatial distribution of gene scores associated with the NMF factors most correlated with the fibrogenic niche, along with the contribution of key genes to each factor. i) Spatial FeaturePlots showing the anatomical distribution of Tnc expression in standard Visium. j) A heatmap showing the correlation between NMF factors and cell type deconvolution scores in Visium HD spatial transcriptomics data. k) Spatial distribution of NMF factors (NMF3 and NMF11) associated with the fibrogenic niche in Visium HD data, along with their corresponding high‐contributing genes. l) Spatial FeaturePlots showing the anatomical distribution of Tnc expression in Visium HD datasets. m) Immunofluorescence staining demonstrates colocalization of TNC with macrophages (F4/80⁺) in the CMJ interstitial region. From top to bottom: an overview merged image (Merge), followed by magnified views of TNC, Vimentin, and F4/80 staining in the same region, and an enlarged merged image (Enlarged Merge) at the bottom.

Journal: Advanced Science

Article Title: Single Cell and Spatial Transcriptomics Define a Proinflammatory and Profibrotic Niche After Kidney Injury

doi: 10.1002/advs.202503691

Figure Lengend Snippet: High‐resolution spatial transcriptomics and immunostaining reveal the TNC‐enriched fibroblast‐macrophage niche organization in fibrotic kidneys. a) Schematic diagram of the Visium HD workflow applied to kidney tissues from sham and UIRI model mice. b) UMAP visualization of integrated Visium HD spatial transcriptomics data from control mice (obtained from the 10x Genomics public dataset) and UIRI mice (this study), processed using canonical correlation analysis (CCA). This dimensionality reduction visualization reveals distinct clusters representing various renal parenchymal and stromal cell populations, including: Glomerulus, Vasculature, PTS1, PTS2, PTS1S2, InjPT, ascending limbs of Henle in cortex [ALOH(Cortex)], distal tubule and connecting tubule (DT_CNT), connecting tubule and collecting duct (CNT_CD), collecting duct in cortex [CD(Cortex)], PTS3, injured PTS3 (InjPTS3), Fibrogenic Niche, Vasa recta, loop of Henle in outer medulla [LOH(IOM)], collecting duct in outer medulla [CD(IOM)], collecting duct in inner medulla [CD(IM)], thin ascending limbs of Henle in inner medulla [tALOH(IM)], renal capsule (RC), Perirenal Fibrous tissue, and Perirenal Adipose tissue. c) Bubble plot comparing the regional distribution in Control versus UIRI 10d kidneys (Visium HD). d) Bubble plot depicting the expression patterns of marker genes across distinct renal cell regions in Visium HD data. e) Spatial maps generated using Visium HD illustrate the inferred anatomical distribution of renal cell regions in kidney tissues from Control and UIRI mice. f) Spatial Feature Plots of Visium HD data showing the spatial distribution of selected renal cell types in controls (top) and UIRI mice (bottom), based on cell‐type deconvolution using RCTD. g) A heatmap showing the correlation between NMF factors and cell‐type deconvolution scores in standard Visium spatial transcriptomics data. h) Spatial distribution of gene scores associated with the NMF factors most correlated with the fibrogenic niche, along with the contribution of key genes to each factor. i) Spatial FeaturePlots showing the anatomical distribution of Tnc expression in standard Visium. j) A heatmap showing the correlation between NMF factors and cell type deconvolution scores in Visium HD spatial transcriptomics data. k) Spatial distribution of NMF factors (NMF3 and NMF11) associated with the fibrogenic niche in Visium HD data, along with their corresponding high‐contributing genes. l) Spatial FeaturePlots showing the anatomical distribution of Tnc expression in Visium HD datasets. m) Immunofluorescence staining demonstrates colocalization of TNC with macrophages (F4/80⁺) in the CMJ interstitial region. From top to bottom: an overview merged image (Merge), followed by magnified views of TNC, Vimentin, and F4/80 staining in the same region, and an enlarged merged image (Enlarged Merge) at the bottom.

Article Snippet: For the preparation of sections for Visium Spatial Transcriptomics sequencing, samples were equilibrated at −18 °C and a 10 μm thick section was cut onto the active sequencing area (6 mm x 6 mm) of a spatial barcoded slide.

Techniques: Immunostaining, Control, Expressing, Marker, Generated, Immunofluorescence, Staining

TLR4 knockout in macrophages attenuates renal inflammation and renal fibrosis in vivo. a) The diagram shows the experimental protocol. Bone marrow chimera models were established by transplanting the WT bone marrow to WT mice, or TLR4 KO bone marrow to WT mice. Mice were irradiated at a single dose of 1100 Rads and then underwent bone marrow transplantation. After 8 weeks of successful transplantation, a unilateral ischemia‐reperfusion (UIRI) model was established. b) PCR‐based identification of kidney genotypes in the recipient mice of bone marrow transplantation models using TLR4 mutation site primers and wild‐type site primers, respectively. c,d) Graphic presentations show serum creatinine (Scr) (c) and blood urea nitrogen (BUN) (d) levels in different groups as indicated at 11 days after IRI. * p < 0.05 versus WT‐WT (n = 4–6). e,f) Western blot analyses show renal expression of TLR4, p‐P65, and P65 in different groups as indicated. Representative Western blot (e) and quantitative data (f) are shown. * p < 0.05 versus WT‐WT (n = 4–6). g) Representative micrographs show renal expression and co‐localization of TLR4 and F4/80 by immunofluorescence staining in different groups as indicated. The areas between the dashed lines represent the corticomedullary junction of the kidney. h,i) Western blot analyses show renal expression of MR, Arg‐1, iNOS, TNF‐α, and CCL2 in different groups as indicated. Representative Western blot (h) and quantitative data (i) are shown. * p < 0.05 versus WT‐WT (n = 4–6). j,k) Western blot analyses show renal expression of TNC, FN, and α‐SMA in different groups as indicated. Representative Western blot (j) and quantitative data (k) are shown. * p < 0.05 versus WT‐WT (n = 4–6). l) A schematic diagram shows a crucial role of TNC in organizing the proinflammatory and profibrotic niche. By integrating single‐cell RNA sequencing and spatial transcriptomics, we unveil TNC as a central organizer of the proinflammatory and profibrotic niche in kidney fibrosis. TNC promotes macrophage activation through TLR4/NF‐κB signaling, leading to macrophage activation, proliferation, and cytokine production.

Journal: Advanced Science

Article Title: Single Cell and Spatial Transcriptomics Define a Proinflammatory and Profibrotic Niche After Kidney Injury

doi: 10.1002/advs.202503691

Figure Lengend Snippet: TLR4 knockout in macrophages attenuates renal inflammation and renal fibrosis in vivo. a) The diagram shows the experimental protocol. Bone marrow chimera models were established by transplanting the WT bone marrow to WT mice, or TLR4 KO bone marrow to WT mice. Mice were irradiated at a single dose of 1100 Rads and then underwent bone marrow transplantation. After 8 weeks of successful transplantation, a unilateral ischemia‐reperfusion (UIRI) model was established. b) PCR‐based identification of kidney genotypes in the recipient mice of bone marrow transplantation models using TLR4 mutation site primers and wild‐type site primers, respectively. c,d) Graphic presentations show serum creatinine (Scr) (c) and blood urea nitrogen (BUN) (d) levels in different groups as indicated at 11 days after IRI. * p < 0.05 versus WT‐WT (n = 4–6). e,f) Western blot analyses show renal expression of TLR4, p‐P65, and P65 in different groups as indicated. Representative Western blot (e) and quantitative data (f) are shown. * p < 0.05 versus WT‐WT (n = 4–6). g) Representative micrographs show renal expression and co‐localization of TLR4 and F4/80 by immunofluorescence staining in different groups as indicated. The areas between the dashed lines represent the corticomedullary junction of the kidney. h,i) Western blot analyses show renal expression of MR, Arg‐1, iNOS, TNF‐α, and CCL2 in different groups as indicated. Representative Western blot (h) and quantitative data (i) are shown. * p < 0.05 versus WT‐WT (n = 4–6). j,k) Western blot analyses show renal expression of TNC, FN, and α‐SMA in different groups as indicated. Representative Western blot (j) and quantitative data (k) are shown. * p < 0.05 versus WT‐WT (n = 4–6). l) A schematic diagram shows a crucial role of TNC in organizing the proinflammatory and profibrotic niche. By integrating single‐cell RNA sequencing and spatial transcriptomics, we unveil TNC as a central organizer of the proinflammatory and profibrotic niche in kidney fibrosis. TNC promotes macrophage activation through TLR4/NF‐κB signaling, leading to macrophage activation, proliferation, and cytokine production.

Article Snippet: For the preparation of sections for Visium Spatial Transcriptomics sequencing, samples were equilibrated at −18 °C and a 10 μm thick section was cut onto the active sequencing area (6 mm x 6 mm) of a spatial barcoded slide.

Techniques: Knock-Out, In Vivo, Irradiation, Transplantation Assay, Mutagenesis, Western Blot, Expressing, Immunofluorescence, Staining, RNA Sequencing, Activation Assay

A. Acquisition of paired breast cancer spatial transcriptomics datasets and histology images from 10x Visium and Xenium. B. Co-registration of Visium and Xenium histology slides into a common coordinate system. The green box highlights the overlapping region retained between the two technologies. C. Rasterization of gene counts onto a uniform grid matched to Visium spot resolution, followed by extraction of the overlapping tissue region. Expression is visualized as patches. D. Training of deep learning models to predict per-patch gene expression from histology image patches. E. Performance evaluation on held-out replicates, comparison across technologies, and ablation experiments of inputs.

Journal: bioRxiv

Article Title: Impact of Data Quality on Deep Learning Prediction of Spatial Transcriptomics from Histology Images

doi: 10.1101/2025.09.04.674228

Figure Lengend Snippet: A. Acquisition of paired breast cancer spatial transcriptomics datasets and histology images from 10x Visium and Xenium. B. Co-registration of Visium and Xenium histology slides into a common coordinate system. The green box highlights the overlapping region retained between the two technologies. C. Rasterization of gene counts onto a uniform grid matched to Visium spot resolution, followed by extraction of the overlapping tissue region. Expression is visualized as patches. D. Training of deep learning models to predict per-patch gene expression from histology image patches. E. Performance evaluation on held-out replicates, comparison across technologies, and ablation experiments of inputs.

Article Snippet: Here, we investigate how variation in molecular and image data quality stemming from differences in imaging (Xenium) versus sequencing (Visium) spatial transcriptomics technologies impact deep learning-based gene expression prediction from histology images.

Techniques: Extraction, Expressing, Gene Expression, Comparison

Histogram showing the distribution of Pearson correlation coefficients for gene expression predictions using Visium and Xenium data. The dotted vertical line denotes the mean PCC, and the solid curved line traces the density estimate. Results are computed on the held-out test set and represent the average performance across five independently trained models. B. Scatterplot comparing the Pearson correlation coefficients of predictions from Visium and Xenium data. The gray dotted line denotes x=y, and select genes corresponding to (C) labeled. C. Representative examples of ground truth and predicted gene expression for HDC , ANKRD30A , AHSP , and GZMK in both the Visium and Xenium datasets. Predicted gene expressions are visualized for the full dataset, while the performance metrics (PCC and normalized rMSE) are computed from the held-out test set only.

Journal: bioRxiv

Article Title: Impact of Data Quality on Deep Learning Prediction of Spatial Transcriptomics from Histology Images

doi: 10.1101/2025.09.04.674228

Figure Lengend Snippet: Histogram showing the distribution of Pearson correlation coefficients for gene expression predictions using Visium and Xenium data. The dotted vertical line denotes the mean PCC, and the solid curved line traces the density estimate. Results are computed on the held-out test set and represent the average performance across five independently trained models. B. Scatterplot comparing the Pearson correlation coefficients of predictions from Visium and Xenium data. The gray dotted line denotes x=y, and select genes corresponding to (C) labeled. C. Representative examples of ground truth and predicted gene expression for HDC , ANKRD30A , AHSP , and GZMK in both the Visium and Xenium datasets. Predicted gene expressions are visualized for the full dataset, while the performance metrics (PCC and normalized rMSE) are computed from the held-out test set only.

Article Snippet: Here, we investigate how variation in molecular and image data quality stemming from differences in imaging (Xenium) versus sequencing (Visium) spatial transcriptomics technologies impact deep learning-based gene expression prediction from histology images.

Techniques: Gene Expression, Labeling

A. Histogram showing the distribution of normalized rMSE for gene expression predictions using Visium and Xenium data. The dotted vertical line denotes the mean rMSE, and the solid curved line traces the density estimate. Results are computed on the test set and represent the average performance across five independently trained models. B. Scatterplot comparing the normalized rMSE of predictions from Visium and Xenium data, based on the test set and averaged over five models. The gray dotted line denotes x=y.

Journal: bioRxiv

Article Title: Impact of Data Quality on Deep Learning Prediction of Spatial Transcriptomics from Histology Images

doi: 10.1101/2025.09.04.674228

Figure Lengend Snippet: A. Histogram showing the distribution of normalized rMSE for gene expression predictions using Visium and Xenium data. The dotted vertical line denotes the mean rMSE, and the solid curved line traces the density estimate. Results are computed on the test set and represent the average performance across five independently trained models. B. Scatterplot comparing the normalized rMSE of predictions from Visium and Xenium data, based on the test set and averaged over five models. The gray dotted line denotes x=y.

Article Snippet: Here, we investigate how variation in molecular and image data quality stemming from differences in imaging (Xenium) versus sequencing (Visium) spatial transcriptomics technologies impact deep learning-based gene expression prediction from histology images.

Techniques: Gene Expression

A. Histogram of Pearson correlation coefficients for gene expression predictions using Visium and Xenium data with the Visium image. The dotted vertical line denotes the mean PCC, and the solid curved line traces the density estimate. B. Scatterplot comparing PCC values from Visium and Xenium data with the Visium image on the test set, averaged across five models. The gray dotted line denotes x=y. C. Histogram of PCC values for predictions using Visium and Xenium data with the Xenium image. The dotted vertical line denotes the mean PCC, and the solid curved line traces the density estimate. D. Scatterplot comparing PCC values from Visium and Xenium data with the Xenium image on the test set, averaged across five models. The gray dotted line denotes x=y. E. Scatterplot comparing PCC values between Xenium, an increasing amount of sparsity in the Xenium dataset, and the Visium results on the test and replicate 2 Xenium data. The dotted line indicates the dataset used, and error bars represent the standard error across five runs. The histogram below denotes the total number of genes used to calculate the mean PCC. F. Scatterplot comparing PCC values between Xenium, an increasing amount of Poisson noise in the Xenium dataset, and the Visium results on the test and replicate 2 Xenium data. The dotted line indicates the dataset used, and error bars represent the standard error across five runs. G. Scatterplot comparing PCC values between Visium, various imputation methods on the Visium dataset, and the Xenium results on the test and replicate 2 Xenium data. The dotted line indicates the dataset used, and error bars represent the standard error across five runs.

Journal: bioRxiv

Article Title: Impact of Data Quality on Deep Learning Prediction of Spatial Transcriptomics from Histology Images

doi: 10.1101/2025.09.04.674228

Figure Lengend Snippet: A. Histogram of Pearson correlation coefficients for gene expression predictions using Visium and Xenium data with the Visium image. The dotted vertical line denotes the mean PCC, and the solid curved line traces the density estimate. B. Scatterplot comparing PCC values from Visium and Xenium data with the Visium image on the test set, averaged across five models. The gray dotted line denotes x=y. C. Histogram of PCC values for predictions using Visium and Xenium data with the Xenium image. The dotted vertical line denotes the mean PCC, and the solid curved line traces the density estimate. D. Scatterplot comparing PCC values from Visium and Xenium data with the Xenium image on the test set, averaged across five models. The gray dotted line denotes x=y. E. Scatterplot comparing PCC values between Xenium, an increasing amount of sparsity in the Xenium dataset, and the Visium results on the test and replicate 2 Xenium data. The dotted line indicates the dataset used, and error bars represent the standard error across five runs. The histogram below denotes the total number of genes used to calculate the mean PCC. F. Scatterplot comparing PCC values between Xenium, an increasing amount of Poisson noise in the Xenium dataset, and the Visium results on the test and replicate 2 Xenium data. The dotted line indicates the dataset used, and error bars represent the standard error across five runs. G. Scatterplot comparing PCC values between Visium, various imputation methods on the Visium dataset, and the Xenium results on the test and replicate 2 Xenium data. The dotted line indicates the dataset used, and error bars represent the standard error across five runs.

Article Snippet: Here, we investigate how variation in molecular and image data quality stemming from differences in imaging (Xenium) versus sequencing (Visium) spatial transcriptomics technologies impact deep learning-based gene expression prediction from histology images.

Techniques: Gene Expression

Scatterplots of normalized rMSE for models trained on varied molecular inputs, evaluated on the held-out test set and averaged across five independent runs, using (A) the Visium histology image and (B) the Xenium histology image. The gray dotted line denotes x=y.

Journal: bioRxiv

Article Title: Impact of Data Quality on Deep Learning Prediction of Spatial Transcriptomics from Histology Images

doi: 10.1101/2025.09.04.674228

Figure Lengend Snippet: Scatterplots of normalized rMSE for models trained on varied molecular inputs, evaluated on the held-out test set and averaged across five independent runs, using (A) the Visium histology image and (B) the Xenium histology image. The gray dotted line denotes x=y.

Article Snippet: Here, we investigate how variation in molecular and image data quality stemming from differences in imaging (Xenium) versus sequencing (Visium) spatial transcriptomics technologies impact deep learning-based gene expression prediction from histology images.

Techniques:

Violin plots of the per-patch fraction of zero counts in Visium and Xenium molecular data. The shape of each violin reflects the density of values along the y-axis, and the overlaid boxplot indicates the median and the 25th and 75th percentiles.

Journal: bioRxiv

Article Title: Impact of Data Quality on Deep Learning Prediction of Spatial Transcriptomics from Histology Images

doi: 10.1101/2025.09.04.674228

Figure Lengend Snippet: Violin plots of the per-patch fraction of zero counts in Visium and Xenium molecular data. The shape of each violin reflects the density of values along the y-axis, and the overlaid boxplot indicates the median and the 25th and 75th percentiles.

Article Snippet: Here, we investigate how variation in molecular and image data quality stemming from differences in imaging (Xenium) versus sequencing (Visium) spatial transcriptomics technologies impact deep learning-based gene expression prediction from histology images.

Techniques:

A. Histogram showing the distribution of Pearson correlation coefficients for gene expression predictions using Visium data with the Visium and Xenium images. The dotted vertical line denotes the mean PCC, and the solid curved line traces the density estimate. Results are computed on the test set and represent the average performance across five independently trained models. B. Scatterplot comparing the Pearson correlation coefficients of predictions from Visium data with the Visium and Xenium images, based on the test set and averaged over five models. The gray dotted line denotes x=y. C. Histogram showing the distribution of Pearson correlation coefficients for gene expression predictions using the Xenium data with the Visium and Xenium image. The dotted vertical line denotes the mean PCC, and the solid curved line traces the density estimate. Results are computed on the test set and represent the average performance across five independently trained models. D. Scatterplot comparing the Pearson correlation coefficients of predictions from Xenium data with the Visium and Xenium image, based on the test set and averaged over five models. The gray dotted line denotes x=y. E. Scatterplot of mean Pearson correlation coefficients on both the test set and the Replicate 2 Xenium section, comparing the Xenium, Xenium images with increasing Gaussian blur, and Visium results (all applied with the same blur levels). The dotted line indicates the dataset used, and error bars represent the standard error of the mean across five independent model runs. F. Grad-CAM heatmaps for two select genes: CD4 (T-cell marker) and PDGFRA (fibroblast marker).

Journal: bioRxiv

Article Title: Impact of Data Quality on Deep Learning Prediction of Spatial Transcriptomics from Histology Images

doi: 10.1101/2025.09.04.674228

Figure Lengend Snippet: A. Histogram showing the distribution of Pearson correlation coefficients for gene expression predictions using Visium data with the Visium and Xenium images. The dotted vertical line denotes the mean PCC, and the solid curved line traces the density estimate. Results are computed on the test set and represent the average performance across five independently trained models. B. Scatterplot comparing the Pearson correlation coefficients of predictions from Visium data with the Visium and Xenium images, based on the test set and averaged over five models. The gray dotted line denotes x=y. C. Histogram showing the distribution of Pearson correlation coefficients for gene expression predictions using the Xenium data with the Visium and Xenium image. The dotted vertical line denotes the mean PCC, and the solid curved line traces the density estimate. Results are computed on the test set and represent the average performance across five independently trained models. D. Scatterplot comparing the Pearson correlation coefficients of predictions from Xenium data with the Visium and Xenium image, based on the test set and averaged over five models. The gray dotted line denotes x=y. E. Scatterplot of mean Pearson correlation coefficients on both the test set and the Replicate 2 Xenium section, comparing the Xenium, Xenium images with increasing Gaussian blur, and Visium results (all applied with the same blur levels). The dotted line indicates the dataset used, and error bars represent the standard error of the mean across five independent model runs. F. Grad-CAM heatmaps for two select genes: CD4 (T-cell marker) and PDGFRA (fibroblast marker).

Article Snippet: Here, we investigate how variation in molecular and image data quality stemming from differences in imaging (Xenium) versus sequencing (Visium) spatial transcriptomics technologies impact deep learning-based gene expression prediction from histology images.

Techniques: Gene Expression, Marker

Scatterplots of normalized RMSE for models trained on varied image inputs, evaluated on the held-out test set and averaged across five independent runs, using (A) the Visium molecular data and (B) the Xenium molecular data. The gray dotted line denotes x=y.

Journal: bioRxiv

Article Title: Impact of Data Quality on Deep Learning Prediction of Spatial Transcriptomics from Histology Images

doi: 10.1101/2025.09.04.674228

Figure Lengend Snippet: Scatterplots of normalized RMSE for models trained on varied image inputs, evaluated on the held-out test set and averaged across five independent runs, using (A) the Visium molecular data and (B) the Xenium molecular data. The gray dotted line denotes x=y.

Article Snippet: Here, we investigate how variation in molecular and image data quality stemming from differences in imaging (Xenium) versus sequencing (Visium) spatial transcriptomics technologies impact deep learning-based gene expression prediction from histology images.

Techniques:

A. Histogram showing the distribution of Pearson correlation for gene expression predictions using Visium and Xenium data. The dotted vertical line denotes the mean rMSE, and the solid curved line traces the density estimate. Results are computed on the test set and represent the average performance across five independently trained models. B. Scatterplot comparing the Pearson correlation of predictions from Visium and Xenium data, based on the test set and averaged over five models. The gray dotted line denotes x=y. C. Histogram showing the distribution of normalized rMSE for gene expression predictions using Visium and Xenium data. The dotted vertical line denotes the mean rMSE, and the solid curved line traces the density estimate. Results are computed on the test set and represent the average performance across five independently trained models. B. Scatterplot comparing the normalized rMSE of predictions from Visium and Xenium data, based on the test set and averaged over five models. The gray dotted line denotes x=y.

Journal: bioRxiv

Article Title: Impact of Data Quality on Deep Learning Prediction of Spatial Transcriptomics from Histology Images

doi: 10.1101/2025.09.04.674228

Figure Lengend Snippet: A. Histogram showing the distribution of Pearson correlation for gene expression predictions using Visium and Xenium data. The dotted vertical line denotes the mean rMSE, and the solid curved line traces the density estimate. Results are computed on the test set and represent the average performance across five independently trained models. B. Scatterplot comparing the Pearson correlation of predictions from Visium and Xenium data, based on the test set and averaged over five models. The gray dotted line denotes x=y. C. Histogram showing the distribution of normalized rMSE for gene expression predictions using Visium and Xenium data. The dotted vertical line denotes the mean rMSE, and the solid curved line traces the density estimate. Results are computed on the test set and represent the average performance across five independently trained models. B. Scatterplot comparing the normalized rMSE of predictions from Visium and Xenium data, based on the test set and averaged over five models. The gray dotted line denotes x=y.

Article Snippet: Here, we investigate how variation in molecular and image data quality stemming from differences in imaging (Xenium) versus sequencing (Visium) spatial transcriptomics technologies impact deep learning-based gene expression prediction from histology images.

Techniques: Gene Expression

(A) Procedures of NGS-based method of spatial transcriptomic. (B) Procedures of imaging-based method of spatial transcriptomic. (C) Schematic diagram of MALDI. The process begins with the preparation of the MALDI sample, followed by the application of MALDI for the matrix deposition. Subsequently, laser scanning technology is employed for the collection, processing, and analysis of signals. Finally, the signals and multi-image data are integrated for visualization. Created with Figdraw, https://www.figdraw.com .

Journal: PeerJ

Article Title: The burgeoning spatial multi-omics in human gastrointestinal cancers

doi: 10.7717/peerj.17860

Figure Lengend Snippet: (A) Procedures of NGS-based method of spatial transcriptomic. (B) Procedures of imaging-based method of spatial transcriptomic. (C) Schematic diagram of MALDI. The process begins with the preparation of the MALDI sample, followed by the application of MALDI for the matrix deposition. Subsequently, laser scanning technology is employed for the collection, processing, and analysis of signals. Finally, the signals and multi-image data are integrated for visualization. Created with Figdraw, https://www.figdraw.com .

Article Snippet: Esophageal squamous-cell carcinoma , 10x Genomics Visium spatial transcriptomic sequencing, in addition to scRNA-seq , A total of 29 samples from esophageal squamous cell carcinoma patients, including normal esophagus, high-grade intraepithelial neoplasia, and esophageal squamous cell carcinoma , 2023 ( ; ) .

Techniques: Imaging

The application of spatial profiling technologies in gastrointestinal cancer.

Journal: PeerJ

Article Title: The burgeoning spatial multi-omics in human gastrointestinal cancers

doi: 10.7717/peerj.17860

Figure Lengend Snippet: The application of spatial profiling technologies in gastrointestinal cancer.

Article Snippet: Esophageal squamous-cell carcinoma , 10x Genomics Visium spatial transcriptomic sequencing, in addition to scRNA-seq , A total of 29 samples from esophageal squamous cell carcinoma patients, including normal esophagus, high-grade intraepithelial neoplasia, and esophageal squamous cell carcinoma , 2023 ( ; ) .

Techniques: Sequencing, Next-Generation Sequencing, Multiplex Assay, Ligation, Amplification, Microarray, Mass Spectrometry, Imaging

Spatial Transcriptomics in horizontally sectioned E14.5 mouse diaphragm identifies distinct tissues and muscle domains (A) Schematic representation of embryonic mouse diaphragm in which relevant anatomical regions are indicated. NMJ: Neuromuscular junction, MTJ: Myotendinous junction. (B) SpatialFeaturePlots demonstrating expression levels and distributions of representative genes for muscle, NMJ, MTJ and tendon. (C) SpatialDimPlot demonstrating the distribution of all the identified clusters within the diaphragm tissue. (D) Spatial distribution of representative Seurat clusters differentiating genetically specific domains in developing mouse diaphragm. (E) Uniform Manifold Approximation and Projection (UMAP) diagram of identified clusters of spatial RNA sequencing with muscle and endothelial clusters at the left and tendon and erythrocyte clusters at right. (F) FeaturePlots showing expression of muscle ( Ttn , Myh3 , Myh8 ), crural diaphragm ( Crlf1 ), NMJ ( Chrna1 , Chrng , Musk, Etv5 ), MTJ ( Col22a1 , Ankrd1 , Rxrg , Csrp3 ) and tendon ( Col12a1 , Antxr1, Tnmd , Tnc ) markers displayed by UMAP.

Journal: iScience

Article Title: Spatial transcriptomics in embryonic mouse diaphragm muscle reveals regional gradients and subdomains of developmental gene expression

doi: 10.1016/j.isci.2024.110018

Figure Lengend Snippet: Spatial Transcriptomics in horizontally sectioned E14.5 mouse diaphragm identifies distinct tissues and muscle domains (A) Schematic representation of embryonic mouse diaphragm in which relevant anatomical regions are indicated. NMJ: Neuromuscular junction, MTJ: Myotendinous junction. (B) SpatialFeaturePlots demonstrating expression levels and distributions of representative genes for muscle, NMJ, MTJ and tendon. (C) SpatialDimPlot demonstrating the distribution of all the identified clusters within the diaphragm tissue. (D) Spatial distribution of representative Seurat clusters differentiating genetically specific domains in developing mouse diaphragm. (E) Uniform Manifold Approximation and Projection (UMAP) diagram of identified clusters of spatial RNA sequencing with muscle and endothelial clusters at the left and tendon and erythrocyte clusters at right. (F) FeaturePlots showing expression of muscle ( Ttn , Myh3 , Myh8 ), crural diaphragm ( Crlf1 ), NMJ ( Chrna1 , Chrng , Musk, Etv5 ), MTJ ( Col22a1 , Ankrd1 , Rxrg , Csrp3 ) and tendon ( Col12a1 , Antxr1, Tnmd , Tnc ) markers displayed by UMAP.

Article Snippet: Visium Spatial Transcriptomics sequencing data were aligned using the default SpaceRanger (2.0.1) pipeline for FFPE slides in a Singularity Container running Ubuntu 22.04 on a high-performance cluster (Medical University of Innsbruck).

Techniques: Expressing, RNA Sequencing

Spatial Transcriptomics reveals distinct myogenic processes in the muscle center and periphery in E14.5 mouse diaphragm (A) SpatialFeaturePlots demonstrating expression levels and distributions of myogenic differentiation markers. (B) VlnPlots of expression levels of genes in clusters identified as muscle center, default muscle, and muscle periphery show an overall increase or decrease in expression of genes involved in muscle development from the center to the periphery. Y axis indicates expression levels. (C) Cnetplots showing GO terms in biological processes (red nodes) and their associated genes (blue nodes) for the upregulated genes in clusters annotated as muscle center compared to muscle periphery (top) or muscle periphery compared to muscle center (bottom). (D) Dotplots of expression of genes involved in myogenesis displaying a declining (right) or increasing (left) gradient in clusters from the muscle center, over default muscle (muscle middle), to the muscle periphery.

Journal: iScience

Article Title: Spatial transcriptomics in embryonic mouse diaphragm muscle reveals regional gradients and subdomains of developmental gene expression

doi: 10.1016/j.isci.2024.110018

Figure Lengend Snippet: Spatial Transcriptomics reveals distinct myogenic processes in the muscle center and periphery in E14.5 mouse diaphragm (A) SpatialFeaturePlots demonstrating expression levels and distributions of myogenic differentiation markers. (B) VlnPlots of expression levels of genes in clusters identified as muscle center, default muscle, and muscle periphery show an overall increase or decrease in expression of genes involved in muscle development from the center to the periphery. Y axis indicates expression levels. (C) Cnetplots showing GO terms in biological processes (red nodes) and their associated genes (blue nodes) for the upregulated genes in clusters annotated as muscle center compared to muscle periphery (top) or muscle periphery compared to muscle center (bottom). (D) Dotplots of expression of genes involved in myogenesis displaying a declining (right) or increasing (left) gradient in clusters from the muscle center, over default muscle (muscle middle), to the muscle periphery.

Article Snippet: Visium Spatial Transcriptomics sequencing data were aligned using the default SpaceRanger (2.0.1) pipeline for FFPE slides in a Singularity Container running Ubuntu 22.04 on a high-performance cluster (Medical University of Innsbruck).

Techniques: Expressing

Spatial Transcriptomics in horizontally sectioned E18.5 mouse diaphragm identifies specific functional muscle domains and fiber types (A) SpatialFeaturePlots demonstrating expression levels and distributions of NMJ genes ( Chrna1 , Musk , Etv5 , Ache , Chrng, Chrne ), neonatal ( Myh8 ) and embryonic ( Myh3 ) myosin heavy chains, developmental troponin Tnnt2 , and ventral diaphragm markers ( Myog , Flnc , Csrp3 ). (B) Spatial distribution of Seurat clusters of distinct muscle and tendon domains. (C) UMAP representation of identified clusters of spatial RNA sequencing indicates spatially and functionally divergent differentiation of diaphragm muscle. (D) FeaturePlots demonstrating expression of muscle ( Ttn , Myh3 , Myh8 ), type I muscle ( Myh7, Myl2, Myl3 ), type IIb muscle ( Myh4 , Pvalb , Mybpc2 ), NMJ ( Chrna1 , Musk , Etv5 ), MTJ ( Col22a1 , Ankrd1 , Uchl1 ) and tendon ( Tnmd , Col11a1 , Scx ) markers displayed by UMAP.

Journal: iScience

Article Title: Spatial transcriptomics in embryonic mouse diaphragm muscle reveals regional gradients and subdomains of developmental gene expression

doi: 10.1016/j.isci.2024.110018

Figure Lengend Snippet: Spatial Transcriptomics in horizontally sectioned E18.5 mouse diaphragm identifies specific functional muscle domains and fiber types (A) SpatialFeaturePlots demonstrating expression levels and distributions of NMJ genes ( Chrna1 , Musk , Etv5 , Ache , Chrng, Chrne ), neonatal ( Myh8 ) and embryonic ( Myh3 ) myosin heavy chains, developmental troponin Tnnt2 , and ventral diaphragm markers ( Myog , Flnc , Csrp3 ). (B) Spatial distribution of Seurat clusters of distinct muscle and tendon domains. (C) UMAP representation of identified clusters of spatial RNA sequencing indicates spatially and functionally divergent differentiation of diaphragm muscle. (D) FeaturePlots demonstrating expression of muscle ( Ttn , Myh3 , Myh8 ), type I muscle ( Myh7, Myl2, Myl3 ), type IIb muscle ( Myh4 , Pvalb , Mybpc2 ), NMJ ( Chrna1 , Musk , Etv5 ), MTJ ( Col22a1 , Ankrd1 , Uchl1 ) and tendon ( Tnmd , Col11a1 , Scx ) markers displayed by UMAP.

Article Snippet: Visium Spatial Transcriptomics sequencing data were aligned using the default SpaceRanger (2.0.1) pipeline for FFPE slides in a Singularity Container running Ubuntu 22.04 on a high-performance cluster (Medical University of Innsbruck).

Techniques: Functional Assay, Expressing, RNA Sequencing

Spatial transcriptomics reveals aberrant regulation of myogenic genes in Ca V 1.1 −/− mice (A) FeaturePlots showing expression of Ttn (muscle), Chrna1 and Musk (NMJ) displayed by UMAP in control and Ca V 1.1 −/− integrated dataset at E14.5 (left) and E18.5 (right). (B) Violin plots showing expression of representative genes differentially expressed in control and Ca V 1.1 −/− samples at E14.5 and E18.5. Y axis indicates expression level. (C) FeaturePlots of module scores of muscle differentiation markers displayed by UMAP in E18.5 control and Ca V 1.1 −/− integrated dataset show increased expression of early markers (top) and a decreased expression of late markers (bottom) in Ca V 1.1 −/− muscles. (D) Venn diagrams of top 200 DEGs genes and GO terms for these genes between E14.5 control and E18.5 control and between E18.5 Ca V 1.1 −/− and E18.5 control muscles indicate more shared genes and GO terms for upregulated genes in E18.5 Ca V 1.1 −/− with E14.5 control muscle and for downregulated genes in E18.5 Ca V 1.1 −/− with E18.5 control muscle. (E) FeaturePlots showing expression of Klf5 and Tead4 displayed by UMAP in control and Ca V 1.1 −/− integrated dataset at E14.5 (left) and E18.5 (right). (F) Violin plots of Klf5 and Tead4 expression in muscle clusters of E14.5 and E18.5 control and Ca V 1.1 −/− spatial datasets. Y axis indicates expression level.

Journal: iScience

Article Title: Spatial transcriptomics in embryonic mouse diaphragm muscle reveals regional gradients and subdomains of developmental gene expression

doi: 10.1016/j.isci.2024.110018

Figure Lengend Snippet: Spatial transcriptomics reveals aberrant regulation of myogenic genes in Ca V 1.1 −/− mice (A) FeaturePlots showing expression of Ttn (muscle), Chrna1 and Musk (NMJ) displayed by UMAP in control and Ca V 1.1 −/− integrated dataset at E14.5 (left) and E18.5 (right). (B) Violin plots showing expression of representative genes differentially expressed in control and Ca V 1.1 −/− samples at E14.5 and E18.5. Y axis indicates expression level. (C) FeaturePlots of module scores of muscle differentiation markers displayed by UMAP in E18.5 control and Ca V 1.1 −/− integrated dataset show increased expression of early markers (top) and a decreased expression of late markers (bottom) in Ca V 1.1 −/− muscles. (D) Venn diagrams of top 200 DEGs genes and GO terms for these genes between E14.5 control and E18.5 control and between E18.5 Ca V 1.1 −/− and E18.5 control muscles indicate more shared genes and GO terms for upregulated genes in E18.5 Ca V 1.1 −/− with E14.5 control muscle and for downregulated genes in E18.5 Ca V 1.1 −/− with E18.5 control muscle. (E) FeaturePlots showing expression of Klf5 and Tead4 displayed by UMAP in control and Ca V 1.1 −/− integrated dataset at E14.5 (left) and E18.5 (right). (F) Violin plots of Klf5 and Tead4 expression in muscle clusters of E14.5 and E18.5 control and Ca V 1.1 −/− spatial datasets. Y axis indicates expression level.

Article Snippet: Visium Spatial Transcriptomics sequencing data were aligned using the default SpaceRanger (2.0.1) pipeline for FFPE slides in a Singularity Container running Ubuntu 22.04 on a high-performance cluster (Medical University of Innsbruck).

Techniques: Expressing, Control, Muscles